EST 344459 is a singleton


Sequence

>344459 (1 EST) Length=63 AGGAAGGTTTTAAAGAGAACAACAGAAATAATGAAACAAATCACTTTCGTTTAGAAATAATAN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 344459: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344459972860L46992SCMRAP079C2/tcz2 adult worm mini-library


Date: 22:39:19 on Thu 23 Nov 117.