EST 344461 is a singleton


Sequence

>344461 (1 EST) Length=42 TCGGAAGCCACGCGAGAGACTGCTTGTACATTCTCCGCTTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 344461: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344461972862L46994SCMRAP081C2/G1 lung-stage schistosomula mini-library


Date: 0:53:46 on Fri 24 Nov 117.