EST 344464 is a singleton


Sequence

>344464 (1 EST) Length=98 GTTGTCAATTGAGGTAGGTAACACTTGATATTCATGAATTAAGGTCGTTATTTGTGTTCTCTTGATGTCAAGAAGAGTTT GTTCCGAAGTTAAACAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 344464: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344464972865L46997SCMRAP084G2/SK lung-stage schistosomula mini-library


Date: 3:50:33 on Sun 19 Nov 117.