EST 344469 is a singleton


Sequence

>344469 (1 EST) Length=145 TATCTTANCGAATTCTTTCTCAAGTTAATGTAAGAAAGAGATGGGTTTGTACAAGTTTTANTCATTTGTTGTACTTGTNT CACACTTGTGTATGTGTGTGAATTTGTGTATATTTACTCATGCTTTTATTAATAGTTATCAGCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 344469: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344469972870L47002SCMRAP089G1/G2 adult worm mini-library


Date: 14:6:27 on Mon 20 Nov 117.