EST 344473 is a singleton


Sequence

>344473 (1 EST) Length=134 CTAGTAATAAATCGTTTCTGATTTTATTTGTGTNTTTTTTATATTTTTCCTGAAAAAAGTTTCCTGAACAAGATGATCAG AAGAAACGATTAATTAATTTAAGTTCANATTCGCTTAGTGTTGTTCACTTGTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 344473: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344473972874L47006SCMRAP093G1/G2 adult worm mini-library


Date: 0:39:16 on Sat 25 Nov 117.