EST 344478 is a singleton


Sequence

>344478 (1 EST) Length=141 CAGNCANNCAGACATTCAGTTACTCAGTCTGCTTCATTCAACACAACATCTGACACTAATCTCCTTCACTCCAAACTCCC AATCGTCATCACCACAGCTGCTTCANATTAACAATACGAACAACAAAACAGTCACATTCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 344478: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344478972879L47011SCMRAP0983303/TCZ2 adult worm mini-library


Date: 23:1:31 on Wed 22 Nov 117.