EST 344479 is a singleton


Sequence

>344479 (1 EST) Length=158 ATCGACCACTTTACTTATCTTGGGAGTCTCATCGGTACTGATGACTTGATCTCTGATGAAATCTTGATACATATTCAGAA GGCTCGATTAGCTTTTAACGACTTGTGTCTCTTGCGCCGTAGGTGAGATATTCGTCTGTCAACAAAAGGACAAGTTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 344479: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344479972880L47012SCMRAP0993303/TCZ2 adult worm mini-library


Date: 17:12:24 on Wed 22 Nov 117.