EST 344481 is a singleton


Sequence

>344481 (1 EST) Length=107 AATTTTGCACCTAACTGTTCATAATTACTGTACAAACGTAATTCATCACAAGCCAATTTCAAATAAAGTGGAATGCTTGC ATCTCGTTTNTGAATTAAAACAGATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 344481: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344481972882L47014SCMRAP1013303/TCZ2 adult worm mini-library


Date: 16:14:56 on Mon 20 Nov 117.