EST 344482 is a singleton


Sequence

>344482 (1 EST) Length=211 GATAGCATTGTTTTAAGTAGTGATAGGAAGAAAAATTTATGAAATTAAGAAATATATAATCAACTTAATAAATGGAGTTA ATGTGAGTGTCATTAATGGANAGGTTGAAATAAAAACACACAATATGAATGATANCCAAGAATTTTATGTAGAAACATTA ATANTAATCATAATAATANANTAGGAGAACGATCTAAAAAGTNGTNNCTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 344482: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344482972883L47015SCMRAP102G1/G1 adult worm mini-library


Date: 4:37:13 on Wed 22 Nov 117.