EST 344484 is a singleton


Sequence

>344484 (1 EST) Length=171 CGAAGTACCTACTTTACAAATCTAGTTAAATATTTATGGAAATCATAAAAATCGTTACATCTCCGAACTGTCCTTACTTT TAATTCCGTCATGTTTTTTTATTACCATATTGCTGATTTNTGATGAGTTGTCAATTTCGACAAGGTAATTGCTAATCCTT TGAAAACTGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 344484: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344484972885L47017SCMRAP1043303/TCZ2 adult worm mini-library


Date: 23:48:27 on Sat 18 Nov 117.