EST 344486 is a singleton


Sequence

>344486 (1 EST) Length=99 AACATTAACGCGGCCTACGTATAATAATCTGCTTGTAGTGGAGCCTCCGTATACAAAACTGCAACCCAATGGAAGAGTTC CTGCATTTCTTAGTACCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 344486: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344486972887L47019SCMRAP1063303/TCZ2 adult worm mini-library


Date: 0:3:13 on Sun 19 Nov 117.