EST 344487 is a singleton


Sequence

>344487 (1 EST) Length=202 CGAGACCATAATCTATGGACGGGTCAATCAAAAGCGTTTGAAGGACCTCGAAGTGACGGCGCTCATTTCAGTATCTGATG CTCATGTACAATCGGTTCACAGAGGATTTTAGAGAAGACTTGACANTTAANCGGCTACANTAAATAGCATTACTAAGAAG TCCCTNTCTTTGCAAGCGCGCGAGCGCTTAACCTCTAGACTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 344487: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344487972888L47020SCMRAP1073303/TCZ2 adult worm mini-library


Date: 18:52:39 on Sat 18 Nov 117.