EST 344489 is a singleton


Sequence

>344489 (1 EST) Length=404 CAGATCCTCGCACTATGAATTTGGGAAGATTCGTCNCNGTTTATACTTTACGAGAAGGATATAACNTTTGTGGGCGTTGT TGGCATGTTAGATCCTCCACGAGCAGAAGTGATTCCTTCAATTAAAGAATGTCGTATGGCCGGTATCCGAGTTATCATGA TCACCGGTGATAACNAAAATACTGCAGAAGCTATTGGTCGTCGTATTGGACTTTNTGCTGAGGACGAAGATTCTACCGGT AAGGCATTTACCGGACGGGAATTTGACGATCTACCACCAGAGCAACAAAAGCGATGCTTGCCGACGAGCTAAACTTTNTG GACGTGTTGGACCCACTCATAATCAAAAATTGGTGGATTTCTTCAAGTCCCATGGGGGAAATTACTTGCCAATGAATTGG CGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 344489: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344489975354R95293SW3ICA408SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 19:20:55 on Sun 19 Nov 117.