EST 344646 is a singleton


Sequence

>344646 (1 EST) Length=320 TTCGGTTCAAGTCAAAACTCAGGACTCACACCAAAAACACCATCAACTACAGTATCAACAACAACAACAACGACAACAGA AACAACAACAGAAACATCAGCTGCTTATTCAACATCTGCCTGGGATAAGAAAACACGTTGGCAAAGATTTCGGATATGGT TACAACTCGTATTGGAATTTCTATGTTGTTTGGTTGGATATTGAATATCGNAACAACCGTATAAACTGAAAAAGGAAAAA CATTTAATACCTATTCTAAATTATCATCATTATGAAGTTGGATGGGCTTNGGGTGGGAAAGTCTAGTGGAATCGANCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 344646: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344646975511R95402SMNHADA009006SKSmAW


Date: 15:15:2 on Thu 23 Nov 117.