EST 344668 is a singleton


Sequence

>344668 (1 EST) Length=220 GCACGCGAAAGAGAAAAGTATGACAACCTTGCTGNAACTCTATGCTGTTATTAACACTATACAATGTTTACAAAAAGCAT ATATTAAGGATTATGTGGAATCAAAAGAATATACTGCTGCCTGTTCAAAGCTTCTTGTCCAGTACAAAGCTGCATTTAAA CAAGTTCANGGAGATGAATTTGCTACTATAGAGGATTTCATGAGAAAAATATAAGATGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 344668: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344668975533R95424SMNHADA009088SKSmAW


Date: 7:22:48 on Sun 19 Nov 117.