EST 344764 is a singleton


Sequence

>344764 (1 EST) Length=222 CCTATTGTAAGTGTCATTCAGCAGTGAGCATCCACCAACTCGTATCATCGCATTCCAGACTGGTATCAACCAATCTCGCG ACAGACCATTCACACATATATCACTGAGACGGCATNCGATGGNGTGTATGTCAAACTCCAACANTTCCATGAAGTTCACT GACCGTTTCATCTATTGTCTTGAGTCAGTNGATATCTCACAACAGACGTGGTTTGNGCTCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 344764: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344764974620L47023SCMRAP1103303/TCZ2 adult worm mini-library


Date: 2:41:49 on Mon 20 Nov 117.