EST 344774 is a singleton


Sequence

>344774 (1 EST) Length=135 TTGAGATGGTTGGGACACGTGTTACGTATGCCAAACCACCGACTTCCCCGANGTGTAATGTTTTCTGTTGTAGGAGTAGG TTGGAAGAAAGNTAGGAGCGGCCAGACCAAAACGTGGCACAANTCTATGANGNCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 344774: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344774974630L47033SCMRAP1203303/TCZ2 adult worm mini-library


Date: 7:29:5 on Sun 19 Nov 117.