EST 344782 is a singleton


Sequence

>344782 (1 EST) Length=242 TTATTTCAGATATAATATTTACATTTCAAGTTAATCAGACGTTTCAAGTGTCTAACGAAGTTACATAATAGTCANAGAAG TAACAAAAATTGANATNATCCATANAGAAAGGCGTGTTAAAGATTATCCACATAACAAACATGAGGAAGATAANGAAGTN CTCCATGANTAGCTTACAAAGGGTTTTCAGGACTACAACAAGATTAGGGATTGGGTNTCTGAACACAAACACCTAGTTTG GA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 344782: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344782974638L47041SCMRAP1283303/TCZ2 adult worm mini-library


Date: 11:46:50 on Wed 22 Nov 117.