EST 344783 is a singleton


Sequence

>344783 (1 EST) Length=279 CACTTCCGATCGTTTCCACGATGTAAACTCATTTAACAAGTATTCCAACCCATCTACAAAGTTTCGTAGACCAATCTTCA AACGCAGACCAAAATACCGGTTTAATAAAAATTCATTTTCTATGCCAGACATTTCGGACATATCTGATGAGTCATTTCAA ACTCCACAAATTAAACCTCACACAACAAAGTTGANTTCACCTGTATCAAGTATACATTNTGNTGCACATTCATCAACTCC TGCACATGCATATATACCTTGATTTANATAACTAATTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 344783: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344783974639L47042SCMRAP1293303/TCZ2 adult worm mini-library


Date: 0:42:35 on Thu 23 Nov 117.