EST 344787 is a singleton


Sequence

>344787 (1 EST) Length=269 GCCAGTAGTCATATGCTTGTCTCAGAGATTAAGCCATGCATGTCTAAGTACATACCTTAAAACGGTGAAACCGCGAATGG CTCATTAAGTCAGCTATGGTTCCTTAGATCGTAAATGCTACATGGATAACTGTAGTAATTCTAGAGCTAATACATGCCTT GAATCCCTGACCCGCAAGGGGACGGGTGCATTTATTAGAACAGNAACCAACCGGGTGCGGCTTCGGGGTGTAGCCTGTTA CAATTCTGTGATGACTCTGGGATAAACTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 344787: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344787974644L47047SCMRAP1343303/TCZ2 adult worm mini-library


Date: 16:13:8 on Fri 17 Nov 117.