EST 344794 is a singleton


Sequence

>344794 (1 EST) Length=92 TCCTGGACGAGATGGGATTATCTATCGAGGTACAATGACAAGACCTAAACAAGATTTGATCCTGCTAACGCATTCACTTT ATTTGTACAAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 344794: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344794974651L47054SCMRAP141C2/SK adult worm mini-library


Date: 12:40:59 on Tue 21 Nov 117.