EST 344798 is a singleton


Sequence

>344798 (1 EST) Length=83 TCGGGGCTTGCAATTATTCCCCGTGAAACGAGGAATTCCTGGTAAGTGCAAGTCATAAGCTTGCGCTGATTACGTCCCTG CCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 344798: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344798974655L47058SCMRAP145C2/SK adult worm mini-library


Date: 6:10:22 on Sun 19 Nov 117.