EST 344799 is a singleton


Sequence

>344799 (1 EST) Length=286 CAAAAGACATTTATGTGAGTTAAAAAAAAATTCAGTGGCTTACTCCCAACTAGATTGCTGTATAGGTAGTATAGCAGTAG TAATAATGAATGCGACTGTACATATTNGGTTACTGGTATTCATCATAAGGCTCTATGTGTGTGTGTGAAGTATAAAGACA ATAAGGGGAAACATTTCTTCATTTTTCACCAACACATGTNCGANACAAAACAATANCGTAGAAAATACTCTGTAACCCTA CATCGCCTAATGTAANGAAANGAGTNCGAGGAGGTGGNAGAAGAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 344799: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344799974656L47059SCMRAP146C2/25RY adult worm mini-library


Date: 16:41:21 on Sat 18 Nov 117.