EST 344810 is a singleton


Sequence

>344810 (1 EST) Length=313 GTTTTTTATCGGAATTTGATCCAGATGAAACTGTATAAGACTGATCAATCAACAATTGGTTTGAAGTTATAATAGATATA CATTTAGACAGCACTGAATAAACTGTATTCTGATGCCAGTGTNCAGTGTTCANGAGATCAGATCGTACATTANAGGGTAT CTCAACAATTGACGCAGNATGTCTCANCCCCGATTTTACGATTTTGTGGACCACCTACGCNCAAGGTACATTCTGNGAAG CGGAGGTGGCCCTNANACCACGCTAACCATTTCTTTTTCTGGNTCTCCTGCTCCTNNTCCANTCCTCCACTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 344810: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344810974667L47070SCMRAP157C2/25RY adult worm mini-library


Date: 2:15:34 on Wed 22 Nov 117.