EST 344816 is a singleton


Sequence

>344816 (1 EST) Length=122 ACTTTTGGTATTCATTCTTTTTAGATTCTAAACTTATTATTATTAATAATTAGATCATTAGTTTGTATTCATTCAAATGT ATGTAACTAACTAGTATCTATATTAATTTATTCANTCTACAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 344816: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344816974673L47076SCMRAP163C2/SK adult worm mini-library


Date: 21:29:4 on Fri 24 Nov 117.