EST 344817 is a singleton


Sequence

>344817 (1 EST) Length=321 GAACTCAAATGTAATACCAGTCGGTAAATTTGTGTCAGAAAGTGTGGAATCACTGGTAAGAATCTGAGAGATGAATATGA GCTATGGCTTGAAGCAGTGATGGAAAATAAGTACTATTCAATTTGATTATATAGAAACATAACAAACAGTANCATTTACA TTTGAACTATGAAAGGGTAAAATATCAAACCGANACATNCAATACTCTTCTATTANTCCANAGNCGATGGACAGAGTCCT CANAATTTATTCCACNATNAGAGCTCAATATCACNTCATAACTTCTTACTATTCTGCTTCANTCGTTTCCTTCTATNNCC C


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 344817: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344817974674L47077SCMRAP164C2/SK adult worm mini-library


Date: 4:34:12 on Mon 20 Nov 117.