EST 344824 is a singleton


Sequence

>344824 (1 EST) Length=434 GATTCGAGCTCGGTACCCGAAGGCTGGTAAACAAAAGGACAATAATTAGAAGCTGATTACAATAAAACTCAAACGAGATG AGTTTCTTGTGTTATGTAAATCAAGTAAAATGATTTCATACAATGTGTATAAGGGAAAACAAACCAAATTATAGGGTTTG ACTCAATTCTTATAAATAAAGAGAATTTAACATTTTGGTAGAGCGTATGTCGGCTATACTGAATGTATGAAAAAAAGTNG TTACACGNCTACACGATATATTCTTACTTTTTGGGACAGGCGAATTATTCTAACCATCTCAAGTTATTTTGGGGCATCCC ATACAATGTTGAACCTTGGAGAAAAGTGGTTGTTTTNAANTCTTTAAATGNAATAACAAGCTCTTGGCGGGGGGGTCCCN CCNAGGAGGTCCGGCCCCGGNCAGGGCCTTTCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 344824: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344824974681L47084SCMRAP171C2/25RY adult worm mini-library


Date: 19:44:26 on Mon 20 Nov 117.