EST 344837 is a singleton


Sequence

>344837 (1 EST) Length=201 TGAAGCCGGATGTAGCAGTCGAATCGAGTGATAAGCCTGAAAACGTTAGTGGAACTTAAGCACCCCNANGGAAAGTNNAA AAGGTAAGAGGGTGTAGAAGTCGTCCTGAGCCTAAAGACAAAGCTGAAAACCCTAACACAGACAAGGCTGAAGAAGCCGA AGACAGTTGGAAACGCGCAAAGGCGNAGAACCGGAAAAGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 344837: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344837974694L47097SCMRAP184tcz3/ks adult worm mini-library


Date: 8:33:17 on Fri 24 Nov 117.