EST 344838 is a singleton


Sequence

>344838 (1 EST) Length=362 CTTAGAGAAGGTTCCAGTTTGTGCATGCCGAAACTGTTGCTGTGAAAAGTTTTAAAGATGGGAGCAAGAAGAACAAGAGT TGGCCTCCAAAGCTCTTCGTATACAAATTAAACGATTCTACTTAGTATAAAGCAAAATTGNTNGGTCGCTTCGTGAAAAT AACTGAAGTCGGCAATGGAGGCAGAAATCACGCATCTTGATGTCAATGCCTGTTGCTCTGGAAATGAAGGAAAACTTAAC AAACTTAGTNACCACATATAGNCACTAACATCTCACAATCGCGAGTCACTCGCACAAGATGGGCGCATCGGTCTGNCATT ATTGTTCGGGATAGCAGGGCTATTATCTTGATCTCAAAGGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 344838: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344838974695L47098SCMRAP185tcz3/ks adult worm mini-library


Date: 2:50:30 on Sat 25 Nov 117.