EST 344840 is a singleton


Sequence

>344840 (1 EST) Length=219 TTGTGTATGATTGTTGAATTGATTTCATCACAACAGGAACCCGAAACTGTTGACTCAAGCCATGATACTCACGATGTATC TATTCAAACTGACTATGATTCATCATTGAATGATCCAGTTGCAATTCTACAAGAATCAATCAATGAACTTAAATTATTGA GAAAGATCTTAGTGATTTAATCAATAAATTAGATTATGAATCTCCATCAAGTTCTTCGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 344840: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344840975896R95494EST000047S. mansoni cDNA


Date: 16:6:9 on Fri 17 Nov 117.