EST 344848 is a singleton


Sequence

>344848 (1 EST) Length=109 CGCGACAACAAAACCTTCCTAGCAACCCAAGACCACAAACCATATATCCTATCGAAAGTCGACGAATTTCTGAAGCTGGT GGCAAAGTTATGTTGTCTCGCGTTAATGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 344848: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344848975904R95502EST000060S. mansoni cDNA


Date: 17:51:55 on Mon 20 Nov 117.