EST 344850 is a singleton


Sequence

>344850 (1 EST) Length=304 TGTTTGCCAAGCGTTAAGAGGATTGGGAGCTTTCGTTTGTATTTCGGAAATAGATCCGATTTGTGCACTTCAAGCCTGCA TGGATGGTTATCGTGTTGTAAAAATTGATGAAGTTATACGTTCAGTGGATATTGTGGTTACTTGCACTGGGAATAAAGGT GTCATTACTCGGGCTCATATGGATCAAATGAAAAGTGGTTGTGTTGTATGCAATATGGGTCACTCTNACACCGAAATCGA TGTTCGATCTCTTCAAACACCTGATTTANCATGGGAGCGTGTTCGATCACACGTGGATCACGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 344850: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344850975906R95536SMNHADA001001SKSmAW


Date: 21:59:26 on Sat 18 Nov 117.