EST 344864 is a singleton


Sequence

>344864 (1 EST) Length=222 ATCCAGGCTGCTATTAAAGATTATAAGAAAAAGTCTACTTGAGTATTACTTTATAAGCACAAATCAATCCCAATCATATT CGANGTCATAATTTCTCATTTCACTTAGATAGACATTATTGTAAATCATAAGCACTATATTGAAAGTCATTTGGTTATCT AACAAATTTAACCATAGATACAGAGATACTCTCATAATAATAAAGTTGGTTTTCATCTACCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 344864: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344864975920R95550SMNHADA007027SKSmAW


Date: 14:59:42 on Fri 24 Nov 117.