EST 344876 is a singleton


Sequence

>344876 (1 EST) Length=319 ATCTGCTTCCAAATGCAAGTCCCGACGACAGTAAAGTTTTCTTCTTGAAAATGCAAGGCGATTACTACCGGTATCTCGCT GAGGTTGNCACTGATGATGTTCGGACAGAAGTGGTCCAGAAATCATTGGNTGCTTACACAAAGGCTACTACGGCTGCCGA AAATTTACCTACCACTCATCCAATNCGTCTTGGTTTAGCTCTCAACTTCTCTGTATTCTTTTACGAAATTCANAATGATG CTGCTAAGGCGTGCGAGTTAGNCAAAAGTGCTTTCGNTTCAGCAATAGCAGGAACTAGATCAGCTTCAAGATGATCCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 344876: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344876975932R95562SMNHADA007084SKSmAW


Date: 11:57:36 on Fri 24 Nov 117.