EST 344884 is a singleton


Sequence

>344884 (1 EST) Length=406 AGGATGACGTTAAATGATACAGAAGTACAACGCCAAATTCGCCACATGATGGCCTTTATAGACCAGGAAGCTCGAGAAAA GGTGGAGGAAATAGATGCCAAAGCCGAAGAAGAGTTTCAAATAGAAAAGTCCCGTCTAGTACAAAACCAACGGCTCAAAA TAATGGAGTACTACTCAACCGCTGTNACAATGTCCCTCCCATTTTTTTGAGCAACGTAATCGGCTATAAGGATGACGTTA AATGATACAGAAGTACAACGCCAAATTCGCCACATGATGGCCTTTATAGACCAGGAAGCTCGAGAAAAGGTGGAGGAAAT AGATGCCAAAGCCGAAGAAGAGTTTCAAATAGAAAAGTCCCGTCTAGTACAAAACCAACGGCTCAAAATAATGGAGTACT ACTCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 344884: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344884975940R95570SMNHADA008025SKSmAW


Date: 20:52:47 on Wed 22 Nov 117.