EST 344899 is a singleton


Sequence

>344899 (1 EST) Length=330 ACGGATCAAAGAAAGAATTGAAGAAAAAGAAGGCATACCACCACAACAACAACGACTGATTTTTTCCGGTAAACAAATGA ATGATGAGAAACTTGTCCAGGAATACAAAATGCAAGGTGGTTCAGTAATCCACTTAGTACTTTCGTTGCGTGGTGGTTTA TGATAATCCTATGTTTCTCCGTTCATTAATGGAACCAGATGAAATCACGTGCTTTTTGTATTATATTGCAAATATGAAGG AGACGGGGCTTTTTGAGTTCTCGTTCCACACCTTTTTCACCTGTTTCTGTGTCATGACTTATTCCCTTCATAATTANTTC AGGGTGATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 344899: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344899975955R95585SMNHADA00E028SKSmAW


Date: 17:59:2 on Fri 17 Nov 117.