EST 344906 is a singleton


Sequence

>344906 (1 EST) Length=368 TTAACTCATTTGGGATAAATGTAAGAAGTTTAAATACAACTCTTGTGAGTGTGTTTATGATCGCATCTGTCGGTGCTTTT ACACTACCATCTTTTCAGGTTCATGGNAGCGTAAACTATTTCATCATTTGGNGGCTTGCTTGAATCTCCTATCTAATTAT ACCGGCATATTCTTGCTGGTTNGTATACATAAAATCCCTTATCAGTTTTATTATGCTCAACTCGGCTGTGTTCTCTCACC CATTTNGTAGTATTGTGTAGGTTACCGCTAGTGTATCACTACTTGGGNGTGTGACATTTGGNAGGTTCATTGTTTNGNCG CGGNCTTTTTTAGGCGATGCGAAGGGCAAGTATTAAACTGTGCTCCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 344906: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344906975962R95592SMNHADA016022T3SmAW


Date: 12:50:3 on Sun 19 Nov 117.