EST 344910 is a singleton


Sequence

>344910 (1 EST) Length=400 GATATCAAAGNAAAAACTGTGTTATGTTGCTTTGGACTNCGATCAAGAAATGAGTACTGCTTCACATAGTTCATCTCTTG AGAAAAGTTATGAATTACCTGATGGTCAGATGATTACAGTTGGAAATGATCGATTTCGATGTCCTGAAGCATTATTTAGA CCAAGTTTCTTAGGTATGGAATGTTCCGGTATTCATGAAACAACTTACAGTTCAATTATGAAATGTGATGTTGGATATTC GTAAAGATCTCTATTCTAATATTGTCCTATCTGGTGGGTTCTACTATGTTCCCTGGGTATTTTCAGATCGTATGCAAAAA AGGAAATTGGTGGTCTTGGCTCCAACAACAATGAAAATTANAATGGTGGCACCACCCGAACGTAAATATTCTGTATTGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 344910: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344910975966R95596SMNHADA017006SKSmAW


Date: 20:8:19 on Sat 18 Nov 117.