EST 344913 is a singleton


Sequence

>344913 (1 EST) Length=400 CCAACACTTTGATCCAACCCTTTNGGTTCAACACTTTTGATCCGACCCTTTTGATCCAACCTTTTGATATTCAAATCATG TCTATCAATCAATTAACTCAAGAACAATGGGATGATTTATTTCATAAATATAAATCATTACGTGAATCAAATAATATTGC ATGGGATGATATAAAAACTGCATTAGAAGTTGTTGGTGTCTCTGTTGCTGGTCATGAAATAAGAGATTTAGTTGGACAAC AAAGGAAATTGGCTTAATCCAGATGAATTTCATGAATTATATNAAAAAGCAAAAGATTTAAAAGATACAACAAAAAGCTA TTAGCAAAGCTTTATTATTAAAACATGCTGAAGATGTGAAGTCAATTTACTGTGGGCAAAAATGATACTGATACTAGACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 344913: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344913975969R95599SMNHADA017018SKSmAW


Date: 14:29:34 on Tue 21 Nov 117.