EST 344926 is a singleton


Sequence

>344926 (1 EST) Length=338 CGTNGATACCTACAAGCCAGGGGATGGTAAACGANTTCCAAAGAAAGGTCAGAGAGTCGTTGTTCATTACACTGGTACCC TCATGGATGGGAAAAAGTTTGATAGNNCACGTGACAGAAATAAACCATTCGAGTTTGTNATTGGGACGGGGAAAGTAATT CGNGGTTGGGATGAAGGTGTTATTCAAATGAGTGTGGGAGAGCGTGCCTACCTTACTTGTACTCCAGACTACGCATATGG TTCCAAGGGGGTCGATAAAGTTATCCCTCCAAATGCTACTCTGAAATTGGATGTGGAGTTAATCGATATNTTATGACTCA TCCCAGGTTTTNCTTACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 344926: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344926975982R95612SMNHADA017069T3SmAW


Date: 11:51:49 on Wed 22 Nov 117.