EST 344935 is a singleton


Sequence

>344935 (1 EST) Length=430 TCATTCTTTTCTGCCTTTACACATAATGAAGATTATAAAGTCGTCTGAAACTGTGNAATGTGCCTCAAGGCATAAAAGTA AAAGCCATTAAAAGAGTGGTTTACGTCAAAGGTCCTCGTGGATCACTGAAACGTGACTTCGGTCATTTGTCCCTAGACAT CAAAGTTTTCTCGAAAAGGATTGTTGTTACAAAGTTTTTTGGGCAACAGAAAGGAGCTAGCTGCTGTCCGGACAGTCTGC TCCCATATTGGAAATATGATAAAAGGTGTTACATCTGGGTATCGTTATAAATTAAAGTCCGTTTATGCCCACTTCCCCAT CAACATGATTCCAGNCAACGACGGTTCCAAGTTGGAGATCCGCAACTTTTTAGGGGGAAAAAGCGACCAAGATGGTNCCT ATGGAATCAGGTGGTAAANGTCTCAGCCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 344935: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344935975991R95506SMNHADA018004SKSmAW


Date: 16:13:22 on Tue 21 Nov 117.