EST 344942 is a singleton


Sequence

>344942 (1 EST) Length=462 ATTTAATTATAGNAAATTATTATTTGGAAAAACATGTTAATTAAACCTTCTAATTCTAATGAAAACAACATAAGTTATTC ACTTCAGAAGTGATTTAAACAGACAGATAAAAAATCATCTGACCATTATTAAACCAGTCATCAAAACATTACTTGTATGT TTGACGTACATAGGCTAAGGAACTCATCATAATCTAGTTCACCATCCTTGTTTTTGGTCATTTTGTGTCATCCAATTACG TAAACTATTTTGGTCTATATCCATACCGGAGGTTTTTAGAAATTCATCCAATTCTTGGATAGGAAACTTTTCCCGAACCA TCCTTGTCTATAGACTGAAACACTTCTCTCCATCGTGCAACAGTCTGCGACATTTGGGACAAAACACCAACTTCTTTTAA GCATTGTGCGATTTCTTCACGTGTAAGGAAACCCATNTTGGGCTTNGGCTTTTGGNGTGGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 344942: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344942975998R95513SMNHADA018021SKSmAW


Date: 9:47:5 on Fri 24 Nov 117.