EST 344943 is a singleton


Sequence

>344943 (1 EST) Length=414 TCCGATCTCAAATATAGATCCATTAGGATTAGAAACACTAAAATGCATTAAGCCACTGCATTCAATGGGCGGAACTGGTG AAAAGAAGCGGTCCAGATATATGGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGGACTATAC TTGTGGTGGCCAAGACCAACGGGGAGAATCAAAAGGAGATGGTCTATGGGGGNCAGGTAAAGCAAGTAATGATACAAAAG AAGCTGCTGGCCGTTGGTGACCTCGTTGGAAACCGATAATAGTTGTGTGGAGGAACTGTTTAAAAGGGAAGTTTAAAGAG GTAAGGNCGCGTTATTCTGTATTGNCTGATATNTTCACANCTATTAAATTTAGGGGNTATTTAAAAACTGNCAAGACTGG TCTTATGATTCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 344943: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344943975999R95514SMNHADA018022SKSmAW


Date: 6:8:59 on Wed 22 Nov 117.