EST 344958 is a singleton


Sequence

>344958 (1 EST) Length=430 GTAATGGACCAGTTGAAGTAGATTTTGAAGTGTATGCCGATTTCCCAAATTACAAATCAGGTGTTTATCAACACGTTAGT GGTGCCCTACTTGGTGGACATGCGGNGCGTTTACTTGGTTGGGGTGAAGAGAATAATGTNCCCTACTGGTTAATTGCGAA TTCATGGAATAGTGATTGGGGTGATAAAGGTTATTTTAAAATAGTTCGTGGTAAAAATGAATGCGGGATTGAAAGTGATG TCAATGCTGGAATACCAAAAATAAAAAACTAGACATTTCGGTAAAATATTTTTATTTGGTACATCTACATGTCTGCAAGT GAATTGGCTTTTTATNATTCATTATCATCATCATCATCATCATCATCATCATCATTATGATTACAATATTTACTTGGGAC ACTGAAGAAACATGATTATTAATTAAAACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 344958: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344958976014R95529SMNHADA018073SKSmAW


Date: 21:26:0 on Fri 24 Nov 117.