EST 345026 is a singleton


Sequence

>345026 (1 EST) Length=174 TACATTTTATTCTACTCATCACGTGTCTGTAGCTTATTTTNGGTGTGACTATAAATATGGATTAACGCTTAGTTAGATGG AGTTGGCTCACACGCCTTCTCCACTGNGTGTCATTTCGCTTCGCTCTCTTCTTTTCGTTTCTTCACTCGTTTGGTCTGGA TCAACGATTGGTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 345026: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
345026981293R95633SMNHADA019062SKSmAW


Date: 13:20:54 on Thu 23 Nov 117.