EST 345029 is a singleton


Sequence

>345029 (1 EST) Length=227 ATGGGATATTTACTAGNAGGACGAATGNATACTTTAGNAACTCAACTNGGCCAAAATACTATTACGACAAATCANTATGA AAAATGGTTTTCAATACTTGGAAAAAGTACATAGTAACGTCAACTCATAACTTGGAAACTCAAATAATTAGCATAACTTA ATGGTTTGGTTTTAATCTGATATAAATTCTCAACAATTTGCATAAAATTATAAATAAAAACAACTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 345029: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
345029981296R95636SMNHADA019070SKSmAW


Date: 0:3:45 on Sun 19 Nov 117.