EST 345037 is a singleton


Sequence

>345037 (1 EST) Length=140 TAGTTCCGGNAAAAAAGGTCCACGGAANCCTTTGGCTGACANCGTCACATTTTTGNTCGCTAAAGAAGANGTTTTACCAA CTGCTCCATATTCTGAAAACAAGATGTAATTAATTTTACAATAAAGCTTGTAGTGGATGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 345037: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
345037981304R95644SMNHADA020005SKSmAW


Date: 19:18:30 on Thu 23 Nov 117.