EST 345048 is a singleton


Sequence

>345048 (1 EST) Length=482 CTGGGCGTGATTGTGGGACGTGATTCGGCTAGTTTAATCGTGCGGTTGTTTATTAGACTGGAATTACTAACTTACAGAAT ATTCCAAGATGGACGTCGATAAAGTGCGCATGGAGNAAGTTGGAGAAGTTAAAGGGGATGAGTGACCAGGTGCGCATCGG TGGAAAAGGTACAGCTCGTCGAAAGAAAAAAGTAGTTCATAAGAATGCTGCTGCTGATGATAAGAAACTACAAAGTTCAT GGAAGAAACTAAACCTCAATACTATCCCAACCATAGAAGAGGTTAACATGTATNAACCAGATGGAACTATGATTCACTTT AAGAATCCAAAAGTCCAAGCAGCTCCACAAGCTAATGTATTCGCAGNTACTGGACAAGCTGAATATAAAACATTAAATGA TTTGTTTCCAAATATGCTCANTCAATGGGAGGACAGCANAATTACGANTGGGNAAAAATGACTGAAANCTCANAANCATC AG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 345048: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
345048981315R95655SMNHADA020048SKSmAW


Date: 14:10:39 on Mon 20 Nov 117.