EST 350150 is a singleton


Sequence

>350150 (1 EST) Length=358 CNAAGATAGGAAATGACNTTTCCGTTNNTATCNAGAAAATAGTAGTTTCAAAGGAACGAAATTCATTAACGANCAGCAGA AGCGATGAGAATTATATAAATGGTAACGGTTCGACTGATTCAGGAGTTTCGCTTGTTGATTCGGACATCGAAANATCAGC AAACTGTACAAANAACANTGACTTGGNTGAACAGGAACGCATCCCATCGATGAAACAAACAGAATCACTGCATGGTGCTA AATTTGNAGTNCCTCTTTTAATTCCGACATTTANAACAAATCTANACCAGACTGATGNCGATAATACTACTGCTATCACT AATACTTCTGTCATATGTAACGCATCAACATGCCACAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 350150: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350150988781H48940SWMFCA050SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 3:57:21 on Sun 19 Nov 117.