EST 350167 is a singleton


Sequence

>350167 (1 EST) Length=148 TCACAAGCCATCTTATCACTACACAGCAGTTCGCCTATCATTAATTCAAATTAGTAGTAGTATCCTCTTTTTTTATTTGT ATTATATTTGTAAACTCCTGATAAAATGTTAAGAATACATAGATTTCTTTATTATCATTTATTATCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 350167: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350167988798H48957SWMFCA004SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 21:14:24 on Fri 24 Nov 117.